Mutation
Slides: 18 Words: 438 Sounds: 0 Effects: 117Mutations. Definition of mutation. Mutations occur randomly in nature and are found in descendants. "Accidents will happen in the best regulated families". Mutations can be dominant or recessive. Dominant mutation yellow. Recessive mutations: nude \left\ and hairless \right\. Varitint waddler. Dominant spotting. Neurological mutation of freezing in any position. A mutation in Japanese waltzing mice causes strange spinning and deafness. Homologous mutations. Identical or similar mutations can occur in species of common origin. Dutch piebald mutation. Hair loss. “Once upon a time there was a tailless cat who caught a tailless mouse.” - Mutation.ppt
Mutation in biology
Slides: 20 Words: 444 Sounds: 0 Effects: 13Alignment... Mutations and selection. Today we will focus on mutations. CDS, coding sequence – gene coding sequence. Replication scheme. Types of mutations. The causes of mutations are varied. CDS mutations and selection. How to display the ancestor-descendant relationship for nucleotides? “Inheritance” of an amino acid residue of a protein. Alignment problem. Alignment example. What to do with leftovers that shouldn't be cleared? Alignment and evolution. Sequences of the envelope protein from two strains of Coxsackievirus. Sequences of the envelope protein from two strains of Coxsackievirus and human enterovirus. - Mutation in biology.ppt
Types of mutations
Slides: 20 Words: 323 Sounds: 0 Effects: 85Mutation is the source of the formation of biological diversity. What is the significance of the occurrence of mutations for the process of evolution? Hypothesis: Mutations can be both harmful and beneficial. Objectives of the study. Types of mutations. How can genetic material change? Mutation. Variability. Genome. Gene. Chromosome. Modification. Hereditary. Non-hereditary. Phenotypic. Genotypic. Environmental conditions. Combinative. Mutational. Mitosis, meiosis, fertilization. Mutations. New sign. Genetic material. Mutagenesis. Mutant. Properties of mutations. Sudden, random, not directed, hereditary, individual, rare. - Types of mutations.ppt
Gene mutations
Slides: 57 Words: 1675 Sounds: 0 Effects: 2Definition. Classification of gene mutations. Nomenclature of gene mutations. The meaning of gene mutations. Biological antimutation mechanisms. Gene properties. We continue to talk about reactions involving DNA. The lecture was difficult to understand. A muton, the smallest unit of mutation, is equal to a pair of complementary nucleotides. Gene mutations. Definition. Let me remind you: The structure of the eukaryotic gene. Gene mutations are any changes in the nucleotide sequence of a gene. Genes. structural - encode a protein or tRNA or rRNA. Regulatory – regulate the work of structural ones. Unique - one copy per genome. - Gene mutations.ppt
Examples of mutations
Slides: 21 Words: 1443 Sounds: 0 Effects: 21Mutations. Goals of work. Introduction. Any change in the DNA sequence. Mutations in the germ cells of parents are inherited by children. Classification of mutations. Genomic mutations. Chromosomes arranged in order of size. Structural mutations. Various types chromosomal mutations. Gene mutations. Hereditary disease phenylketonuria. Examples of mutations. Induced mutagenesis. Linear dependence on the radiation dose. Phenylalanine, an aromatic amino acid. Tyrosine, an aromatic amino acid. The number of mutations decreases sharply. Gene therapy. Tissue transplantation methods. Lungs of mice 3 days after infection with cancer cells. - Examples of mutations.ppt
Mutation process
Slides: 11 Words: 195 Sounds: 0 Effects: 34The evolutionary role of mutations. Population genetics. S.S. Chetverikov. Saturation of natural populations with recessive mutations. Fluctuations in gene frequency in populations depending on the action of factors external environment. Mutation process -. Counted. On average, one gamete out of 100 thousand is 1 million. A gamete carries a mutation at a specific locus. 10-15% of gametes carry mutant alleles. That's why. Natural populations are saturated with a wide variety of mutations. Most organisms are heterozygous for many genes. One can guess. Light-colored - aa Dark-colored - AA. - Mutation process.ppt
Examples of mutational variability
Slides: 35 Words: 1123 Sounds: 0 Effects: 9Mutational variability. Forms of variability. Mutation theory. Classification of mutations. Classification of mutations according to the place of their occurrence. Classification of mutations according to the nature of their manifestation. Dominant mutation. Classification of mutations by adaptive value. Gene mutations. Genomic mutations. Generative mutations. Klinefelter's syndrome. Shershevsky-Turner syndrome. Patau syndrome. Down syndrome. Chromosomal mutations. Deletion. Duplications. Translocations. Replacing bases. Primary structure of hemoglobin. Mutation in a gene. Morphan's syndrome. Adrenaline rush. R. Hemophilia. Prevention. - Examples of mutational variability.ppt
Mutational variability of organisms
Slides: 28 Words: 1196 Sounds: 0 Effects: 12Genetics and evolutionary theory. Problematic question. Target. Tasks. Natural selection is the guiding, driving factor of evolution. Variability is the ability to acquire new characteristics. Variability. Modification variability. Hereditary variability. Combinative variability. Genetic programs. Mutational variability is the primary material. Mutations. The classification is conditional. Chromosomal and genomic mutations. Increasing complexity of the organization of living things. Gene (point) mutations. What happens to the individual? A population is an elementary unit of the evolutionary process. - Mutational variability of organisms.ppt
Types of mutational variability
Slides: 16 Words: 325 Sounds: 0 Effects: 12Mutational variability. Hereditary variability. Factors causing mutations. Characteristics of mutational variability. Types of mutations according to their effect on the body. Types of mutations by changing the genotype. Chromosomal mutations. Chromosomal mutations in animals. Change in the number of chromosomes. Polyploidy. Down syndrome. Changes in gene structure. Genomic mutations. Gene mutations. Types of variability. Homework. - Types of mutational variability.pptx
Mutational variability
Slides: 17 Words: 717 Sounds: 0 Effects: 71Mutational variability. Genetics. From history: Mutations: Mutational variability is associated with the process of formation of mutations. Who created it: Organisms in which a mutation has occurred are called mutants. The mutation theory was created by Hugo de Vries in 1901-1903. Slide separator. According to the method of occurrence In relation to the embryonic path According to the adaptive value. By localization in the cell. Classification of mutations. According to the method of occurrence. There are spontaneous and induced mutations. Mutagens are of three types: Physical, Chemical, Biological. In relation to the germinal path. - Mutational variability.ppt
Hereditary variability
Slides: 14 Words: 189 Sounds: 0 Effects: 0Hereditary variability. Comparison of modification and mutational variability. Let's test our knowledge. Combinative variability. A random combination of genes in a genotype. Mutations – sudden ones persistent changes genes and chromosomes that are inherited. Mechanism of mutations. Genomics lead to changes in the number of chromosomes. Genetic Associated with changes in the nucleotide sequence of a DNA molecule. Chromosomal are associated with changes in the structure of chromosomes. Cytoplasmic is the result of changes in the DNA of cellular organelles - plastids, mitochondria. Examples of chromosomal mutations. - Hereditary variability.ppt
Types of hereditary variability
Slides: 24 Words: 426 Sounds: 0 Effects: 8Hereditary variability. Determine the form of variability. Parents. First generation of descendants. Types of hereditary variability. Object of study. Homozygote. Law of Uniformity. Combinative. Cytoplasmic inheritance. Combinative variability. Types of hereditary variability. Types of hereditary variability. Mutational variability. Types of hereditary variability. Albinism. Types of hereditary variability. Chromosomal mutations. Genomic mutation. Down syndrome. Genomic mutation of cabbage flowers. Gene mutation. Cytoplasmic variability. -
Chromosomal Mutations person
Completed by: 11th grade student Alexandra Karpova
Chromosome
- a thread-like structure of the cell nucleus that carries genetic information in the form of genes, which becomes visible when the cell divides. A chromosome consists of two long polynucleatide chains that form a DNA molecule. The chains are spirally twisted around one another. The nucleus of each human somatic cell contains 46 chromosomes, 23 of which are maternal and 23 are paternal. Each chromosome can reproduce an exact copy of itself between cell divisions, so that each new cell that is formed receives a complete set of chromosomes.
Types of chromosomes perestroika
Translocation- transfer of some part of a chromosome to another place on the same chromosome or to another chromosome. Inversion is an intrachromosomal rearrangement accompanied by a rotation of a chromosomal fragment by 180, which changes the order of the genes of the chromosome (AGVBDE). Deletion is the removal (loss) of a gene section from a chromosome, loss of a chromosome section (chromosome ABCD and chromosome ABGDE).
Duplication (doubling) is a type of chromosomal rearrangement (mutation), consisting in the doubling of any part of a chromosome (chromosome ABCD).
Mutagens
Chemical and physical factors, causing hereditary changes - mutations. Artificial mutations were first obtained in 1925 by G. A. Nadsen and G. S. Filippov in yeast by the action of radium radiation; in 1927, G. Möller obtained mutations in Drosophila by exposure to X-rays. The ability of chemical substances to cause mutations (by the action of iodine on Drosophila) was discovered by I. A. Rapoport. In flies that developed from these larvae, the frequency of mutations was several times higher than in control insects.
Mutation
(lat. mutatio- change) - a persistent (that is, one that can be inherited by the descendants of a given cell or organism) transformation of the genotype, occurring under the influence of external or internal environment. The term was proposed by Hugo de Vries. The process of mutation occurrence is called mutagenesis.
Angelman syndrome
Characteristic external signs: 1. strabismus: hypopigmentation of the skin and eyes; 2. loss of control over tongue movements, difficulties in sucking and swallowing; 3. arms raised, bent during the procession; 4.extended lower jaw; 5. wide mouth, wide spacing between teeth; 6. frequent drooling, protruding tongue; 7. flat back of the head; 8.smooth palms.
Klinefelter syndrome
By the beginning of puberty, characteristic body proportions are formed: patients are often taller than their peers, but unlike typical eunuchoidism, their arm span rarely exceeds the length of the body, and their legs are noticeably longer than the body. In addition, some children with this syndrome may have difficulty learning and expressing their thoughts. Some guidelines indicate that patients with Klinefelter syndrome have slightly reduced testicular volume before puberty.
SYNDROME CAT CRY
BLOOM'S SYNDROME
Characteristic external signs: 1.Short stature 2.Skin rashes that appear immediately after the first exposure sun rays 3. High voice 4. Telangiectasia (extended blood vessels), which may appear on the skin.
PATAU SYNDROME
Trisomy 13 was first described by Thomas Bartolini in 1657, but the chromosomal nature of the disease was established by Dr. Klaus Patau in 1960. The disease is named after him. Patau syndrome has also been described among tribes on a Pacific island. These cases were believed to be caused by radiation from atomic bomb tests.
Thank you for viewing!
Mutations, mutogens, types of mutations, causes of mutations, meaning of mutations
Mutation (lat. mutatio - change) is a persistent (that is, one that can be inherited by the descendants of a given cell or organism) transformation of the genotype that occurs under the influence of the external or internal environment.
The term was proposed by Hugo de Vries.
The process of mutations is called mutagenesis.
Causes of mutations
Mutations are divided into spontaneous and induced.
Spontaneous mutations occur spontaneously throughout the life of an organism under normal environmental conditions with a frequency of approximately one nucleotide per cell generation.
Induced mutations are heritable changes in the genome that arise as a result of certain mutagenic effects in artificial (experimental) conditions or under adverse environmental influences.
Mutations appear constantly during processes occurring in a living cell. The main processes leading to the occurrence of mutations are DNA replication, DNA repair disorders, transcription and genetic recombination.
Relationship between mutations and DNA replication
Many spontaneous chemical changes in nucleotides lead to mutations that occur during replication. For example, due to the deamination of cytosine opposite it, uracil can be included in the DNA chain (a U-G pair is formed instead of the canonical pairs C-G). During DNA replication, adenine is included in the new chain opposite uracil, forming couple U-A, and during the next replication it is replaced by a T-A pair, that is, a transition occurs (a point replacement of a pyrimidine with another pyrimidine or a purine with another purine).
Relationship between mutations and DNA recombination
Of the processes associated with recombination, unequal crossing over most often leads to mutations. It usually occurs in cases where there are several duplicated copies of the original gene on the chromosome that have retained a similar nucleotide sequence. As a result of unequal crossing over, duplication occurs in one of the recombinant chromosomes, and deletion occurs in the other.
Relationship between mutations and DNA repair
Spontaneous DNA damage is quite common and occurs in every cell. To eliminate the consequences of such damage, there are special repair mechanisms (for example, an erroneous section of DNA is cut out and the original one is restored at this place). Mutations occur only when the repair mechanism for some reason does not work or cannot cope with the elimination of damage. Mutations that occur in genes encoding proteins responsible for repair can lead to a multiple increase (mutator effect) or decrease (antimutator effect) in the frequency of mutation of other genes. Thus, mutations in the genes of many enzymes of the excision repair system lead to sharp increase frequency of somatic mutations in humans, and this, in turn, leads to the development of xeroderma pigmentosum and malignant tumors covers. Mutations can appear not only during replication, but also during repair - excision repair or post-replicative repair.
Mutagenesis models
Currently, there are several approaches to explain the nature and mechanisms of mutation formation. Currently, the polymerase model of mutagenesis is generally accepted. It is based on the idea that the only reason for the formation of mutations is random errors in DNA polymerases. In the tautomeric model of mutagenesis proposed by Watson and Crick, the idea was first put forward that mutagenesis is based on the ability of DNA bases to be in different tautomeric forms. The process of mutation formation is considered as a purely physical and chemical phenomenon. The polymerase-tautomeric model of ultraviolet mutagenesis is based on the idea that during the formation of cis-syn cyclobutane pyrimidine dimers, the tautomeric state of their constituent bases can change. Error-prone and SOS synthesis of DNA containing cis-syn cyclobutane pyrimidine dimers is studied. There are other models.
Polymerase model of mutagenesis
In the polymerase model of mutagenesis, it is believed that the only reason for the formation of mutations is sporadic errors in DNA polymerases. The polymerase model of ultraviolet mutagenesis was first proposed by Bresler. He suggested that mutations appear as a result of the fact that DNA polymerases opposite photodimers sometimes insert non-complementary nucleotides. Currently, this point of view is generally accepted. There is a well-known rule (A rule), according to which DNA polymerase most often inserts adenines opposite damaged areas. The polymerase model of mutagenesis explains the nature of targeted base substitution mutations.
Tautomeric model of mutagenesis
Watson and Crick suggested that spontaneous mutagenesis is based on the ability of DNA bases to transform, under certain conditions, into non-canonical tautomeric forms, affecting the nature of base pairing. This hypothesis attracted attention and was actively developed. Rare tautomeric forms of cytosine were discovered in crystals of nucleic acid bases irradiated with ultraviolet light. The results of numerous experimental and theoretical research clearly indicate that DNA bases can transition from canonical tautomeric forms to rare tautomeric states. Much work has been done on the study of rare tautomeric forms of DNA bases. Using quantum mechanical calculations and the Monte Carlo method, it was shown that the tautomeric equilibrium in cytosine-containing dimers and in cytosine hydrate is shifted towards their imino forms both in the gas phase and in aqueous solution. Ultraviolet mutagenesis is explained on this basis. In the guanine-cytosine pair, only one rare tautomeric state will be stable, in which the hydrogen atoms of the first two hydrogen bonds responsible for base pairing simultaneously change their positions. And since this changes the positions of the hydrogen atoms involved in Watson-Crick base pairing, the consequence may be the formation of base substitution mutations, transitions from cytosine to thymine, or the formation of homologous transversions from cytosine to guanine. The participation of rare tautomeric forms in mutagenesis has been discussed repeatedly.
Mutation classifications
There are several classifications of mutations according to various criteria. Möller proposed dividing mutations according to the nature of the change in the functioning of the gene into hypomorphic (the altered alleles act in the same direction as the wild-type alleles; only less protein product is synthesized), amorphous (the mutation looks like a complete loss of gene function, for example, the white mutation in Drosophila ), antimorphic (the mutant trait changes, for example, the color of the corn grain changes from purple to brown) and neomorphic.
In modern educational literature A more formal classification is also used, based on the nature of changes in the structure of individual genes, chromosomes and the genome as a whole. Within this classification, the following types of mutations are distinguished:
genomic;
chromosomal;
genetic
Genomic: - polyploidization (the formation of organisms or cells whose genome is represented by more than two (3n, 4n, 6n, etc.) sets of chromosomes) and aneuploidy (heteroploidy) - a change in the number of chromosomes that is not a multiple of the haploid set (see Inge- Vechtomov, 1989). Depending on the origin of chromosome sets among polyploids, allopolyploids are distinguished, which have sets of chromosomes obtained by hybridization from different types, and autopolyploids, in which the number of chromosome sets of their own genome increases by a multiple of n.
With chromosomal mutations, major rearrangements in the structure of individual chromosomes occur. In this case, there is a loss (deletion) or doubling of a part (duplication) of the genetic material of one or more chromosomes, a change in the orientation of chromosome segments in individual chromosomes (inversion), as well as a transfer of part of the genetic material from one chromosome to another (translocation) (an extreme case - unification of entire chromosomes, the so-called Robertsonian translocation, which is a transitional variant from a chromosomal mutation to a genomic one).
At the gene level, changes in the primary DNA structure of genes under the influence of mutations are less significant than with chromosomal mutations, but gene mutations are more common. As a result of gene mutations, substitutions, deletions and insertions of one or more nucleotides, translocations, duplications and inversions occur various parts gene. In the case when only one nucleotide changes under the influence of a mutation, they speak of point mutations.
Point mutation
A point mutation, or single base substitution, is a type of mutation in DNA or RNA that is characterized by the replacement of one nitrogenous base with another. The term also applies to pairwise nucleotide substitutions. The term point mutation also includes insertions and deletions of one or more nucleotides. There are several types of point mutations.
Base substitution point mutations. Since DNA contains only two types of nitrogenous bases - purines and pyrimidines, all point mutations with base substitutions are divided into two classes: transitions and transversions. Transition is a base substitution mutation, when one purine base is replaced by another purine base (adenine to guanine or vice versa), or a pyrimidine base by another pyrimidine base (thymine to cytosine or vice versa. Transversion is a base substitution mutation, when one purine base is replaced to a pyrimidine base or vice versa). Transitions occur more often than transversions.
Reading frameshift point mutations. They are divided into deletions and insertions. Deletions are frameshift mutations where one or more nucleotides are lost in a DNA molecule. An insertion is a reading frameshift mutation when one or more nucleotides are inserted into a DNA molecule.
Complex mutations also occur. These are changes in DNA when one section of it is replaced by a section of a different length and a different nucleotide composition.
Point mutations can appear opposite damage to the DNA molecule that can stop DNA synthesis. For example, opposite cyclobutane pyrimidine dimers. Such mutations are called target mutations (from the word “target”). Cyclobutane pyrimidine dimers cause both targeted base substitution mutations and targeted frameshift mutations.
Sometimes point mutations occur in so-called undamaged regions of DNA, often in a small vicinity of photodimers. Such mutations are called untargeted base substitution mutations or untargeted frameshift mutations.
Point mutations do not always form immediately after exposure to a mutagen. Sometimes they appear after dozens of replication cycles. This phenomenon is called delayed mutations. With genomic instability, the main cause of the formation of malignant tumors, the number of untargeted and delayed mutations sharply increases.
Four possible genetic consequences point mutations: 1) preservation of the meaning of the codon due to the degeneracy of the genetic code (synonymous nucleotide substitution), 2) change in the meaning of the codon, leading to the replacement of an amino acid in the corresponding place of the polypeptide chain (missense mutation), 3) formation of a meaningless codon with premature termination ( nonsense mutation). There are three meaningless codons in the genetic code: amber - UAG, ocher - UAA and opal - UGA (in accordance with this, mutations leading to the formation of meaningless triplets are also named - for example, amber mutation), 4) reverse substitution (stop codon to sense codon).
Based on their effect on gene expression, mutations are divided into two categories: mutations such as base pair substitutions and
type of reading frame shift (frameshift). The latter are deletions or insertions of nucleotides, the number of which is not a multiple of three, which is associated with the triplet nature of the genetic code.
A primary mutation is sometimes called a direct mutation, and a mutation that restores the original structure of a gene is called a reverse mutation, or reversion. A return to the original phenotype in a mutant organism due to restoration of the function of the mutant gene often occurs not due to true reversion, but due to a mutation in another part of the same gene or even another non-allelic gene. In this case, the recurrent mutation is called a suppressor mutation. The genetic mechanisms due to which the mutant phenotype is suppressed are very diverse.
Kidney mutations (sports) - persistent somatic mutations occurring in the cells of plant growth points. Lead to clonal variability. They are preserved during vegetative propagation. Many varieties of cultivated plants are bud mutations.
Consequences of mutations for cells and organisms
Mutations that impair cell activity in a multicellular organism often lead to cell destruction (in particular, programmed cell death - apoptosis). If intra- and extracellular protective mechanisms do not recognize the mutation and the cell undergoes division, then the mutant gene will be passed on to all descendants of the cell and, most often, leads to the fact that all these cells begin to function differently.
Mutation in somatic cell complex multicellular organism may lead to malignant or benign neoplasms, a mutation in a germ cell leads to a change in the properties of the entire descendant organism.
In stable (unchanged or slightly changing) conditions of existence, most individuals have a genotype close to the optimal one, and mutations cause disruption of the body’s functions, reduce its fitness and can lead to the death of the individual. However, in very rare cases, a mutation can lead to the appearance of new useful signs, and then the consequences of the mutation are positive; in this case, they are a means of adapting the body to environment and, accordingly, are called adaptive.
The role of mutations in evolution
With a significant change in living conditions, those mutations that were previously harmful may turn out to be useful. Thus, mutations are material for natural selection. Thus, melanistic mutants (dark-colored individuals) in birch moth populations in England were first discovered by scientists among typical light-colored individuals in the middle of the 19th century. Dark coloring occurs as a result of a mutation in one gene. Butterflies spend the day on the trunks and branches of trees, usually covered with lichens, against which the light coloring acts as a camouflage. As a result of the industrial revolution, accompanied by air pollution, the lichens died and the light trunks of birch trees became covered with soot. As a result, by the middle of the 20th century (over 50-100 generations), in industrial areas the dark morph almost completely replaced the light one. It was shown that the main reason for the preferential survival of the black form was predation by birds, which selectively ate light-colored butterflies in polluted areas.
If a mutation affects “silent” sections of DNA, or leads to the replacement of one element of the genetic code with a synonymous one, then it usually does not manifest itself in the phenotype (the manifestation of such a synonymous replacement may be associated with different frequencies codon usage). However, such mutations can be detected using gene analysis methods. Since mutations most often occur as a result of natural causes, assuming that the basic properties of the external environment have not changed, it turns out that the frequency of mutations should be approximately constant. This fact can be used to study phylogeny - the study of the origin and relationships of various taxa, including humans. Thus, mutations in silent genes serve as a “molecular clock” for researchers. The “molecular clock” theory also proceeds from the fact that most mutations are neutral, and the rate of their accumulation in a given gene does not depend or weakly depends on the action of natural selection and therefore remains constant for a long time. This rate will, however, differ for different genes.
The study of mutations in mitochondrial DNA (inherited on the maternal line) and in Y chromosomes (inherited on the paternal line) is widely used in evolutionary biology to study the origin of races, nationalities, reconstruction biological development humanity.
The problem of random mutations
In the 40s, a popular point of view among microbiologists was that mutations are caused by exposure to an environmental factor (for example, an antibiotic), to which they allow adaptation. To test this hypothesis, a fluctuation test and a replica method were developed.
The Luria-Delbrück fluctuation test consists of dispersing small portions of the original bacterial culture into test tubes with a liquid medium, and after several cycles of division, an antibiotic is added to the test tubes. Then (without subsequent divisions) the surviving antibiotic-resistant bacteria are seeded onto Petri dishes with solid medium. The test showed that the number of resistant colonies from different tubes is very variable - in most cases it is small (or zero), and in some cases it is very high. This means that the mutations that cause antibiotic resistance arose in random moments time both before and after its exposure.
To use presentation previews, create an account for yourself ( account) Google and log in: https://accounts.google.com
Slide captions:
Mutations Sorokina V.Yu.
Mutations are rare, randomly occurring persistent changes in the genotype that affect the entire genome, entire chromosomes, their parts and individual genes. Causes of mutations: 1. Natural mutation process. 2. Mutation environmental factors.
Mutagens Mutagens are factors through which mutations are formed. Properties of mutagens: Universality Non-directionality of emerging mutations Absence of a lower threshold Based on their origin, mutagens can be divided into endogenous, formed during the life of the body, and exogenous - all other factors, including environmental conditions.
Based on the nature of their occurrence, mutagens are classified into: Physical ( ionizing radiation, x-rays, radiation, ultraviolet radiation; increased temperatures for cold-blooded animals; lowering temperatures for warm-blooded animals). Chemicals (oxidizing and reducing agents (nitrates, nitrites, reactive oxygen species), pesticides, some food additives, organic solvents, medicines etc.) Biological viruses (influenza virus, measles, rubella, etc.).
Classification of mutations By place of origin Generative Somatic (in germ cells, (not inherited) inherited)
By nature of manifestation Beneficial Harmful Neutral Recessive Dominant
By structure Genomic Gene Chromosomal
Genomic mutations Genomic mutations are mutations that lead to a change in the number of chromosomes. The most common type of such mutation is polyploidy - a multiple change in the number of chromosomes. In polyploid organisms, the haploid (n) set of chromosomes in cells is repeated not 2 times, but 4-6 (sometimes 10-12). The main reason This is due to the nondisjunction of homologous chromosomes in meiosis, which leads to the formation of gametes with an increased number of chromosomes.
Gene mutations Gene mutations (or point mutations) are the most common class of mutational changes. Gene mutations are associated with changes in the sequence of nucleotides in a DNA molecule. They lead to the fact that the mutant gene either stops working and then the corresponding RNA and protein are not formed, or a protein with altered properties is synthesized, which manifests itself in changes in any characteristics of organisms. As a consequence of gene mutation, new alleles are formed. This has important evolutionary significance. Gene mutations should be considered the result of “errors” that occur during the DNA duplication process.
Chromosomal mutations Chromosomal mutations are rearrangements of chromosomes. The appearance of chromosomal mutations is always associated with the occurrence of two or more chromosome breaks followed by their joining, but in the wrong order. Chromosomal mutations lead to changes in the functioning of genes. They also play a major role in the evolutionary transformations of species.
1 - normal chromosome, normal gene order 2 - deletion; lack of a section of chromosome 3 - duplication; duplication of a section of chromosome 4 - inversion; rotation of a chromosome section by 180 degrees 5 - translocation; moving a section to a non-homologous chromosome. Centric fusion is also possible, that is, the fusion of non-homologous chromosomes. Different types of chromosomal mutations:
Mutation theory is a theory of variability and evolution created at the beginning of the 20th century. Hugo De Vries. According to M. t., of the two categories of variability - continuous and intermittent (discrete), only the latter is hereditary; To designate it, De Vries introduced the term mutation. According to De Vries, mutations can be progressive - the appearance of new hereditary properties, which is equivalent to the emergence of new elementary species, or regressive - the loss of any of the existing properties, which means the emergence of varieties. Mutation theory
Basic provisions of mutation theory: Mutations are discrete changes in hereditary material. Mutations are rare events. On average, one new mutation occurs per 10,000-1,000,000 genes per generation. Mutations can be transmitted steadily from generation to generation. Mutations arise undirectedly and do not form continuous series of variability. Mutations can be beneficial, harmful or neutral.
Biology
9th grade
Teacher:
Ivanova Natalya Pavlovna
MKOU Dresvyanskaya secondary school
Lesson topic:
Patterns of variability:
mutational variability.
Mutations is a change in genotype that occurs under the influence of external or internal environmental factors.
Hugo (hugo) de Vries (February 16, 1848 G – May 21, 1935 G )
Introduced the modern, genetic concept of mutation to denote rare options traits in the offspring of parents who did not have this trait.
Basic provisions of mutation theory:
- Mutations occur suddenly, spasmodically.
- Mutations are inherited, that is, they are persistently transmitted from generation to generation.
Mutations are not directed: a gene can mutate at any locus, causing changes in both minor and vital signs.
- The same mutations can occur repeatedly.
- Mutations can be beneficial or harmful to the body, dominant or recessive.
According to the nature of the change in the genotype, mutations are divided into three groups:
- Genetic.
- Chromosomal.
- Genomic.
Gene, or point, mutations.
They occur when one or more nucleotides within one gene are replaced by others.
Dropout of bases
ACCTGCGTGCCAAATGTGTGC
Replacing bases.
ACCTGCGTGCCAAATGTGTGC
Thr-Cys-Val-Pro-Tyr-Val-Cys
Thr-Cys-Val-Pro-Tyr-Val-Cys
ACCTGCGT GTGTGC
ACCTG A GTGCCAAATGTGTGC
Thr-Cys-Val- Cys-Val
Thr- STOP - Val-Pro-Tyr-Val-Cys
Adding bases
ACCTGCGTGCCAAATGTGTGC
Thr-Cys-Val-Pro-Tyr-Val-Cys
ACCTGCGTGCCAGTACAATGTGTGC
Thr-Cys-Val-Pro- Phe-Gln-Cys-Val
valine). This leads to the fact that in the blood red blood cells with such hemoglobin are deformed (from round to sickle-shaped) and quickly destroyed. In this case, acute anemia develops and a decrease in the amount of oxygen carried by the blood is observed. Anemia causes physical weakness, problems with the heart and kidneys, and can lead to early death people homozygous for the mutant allele. "width="640" Sickle cell anemia
A recessive allele that causes this in a homozygous state hereditary disease, is expressed in the replacement of just one amino acid residue in ( B - chains of the hemoglobin molecule ( glutamic acid-" - valine). This leads to the fact that in the blood red blood cells with such hemoglobin are deformed (from round to sickle-shaped) and quickly destroyed. In this case, acute anemia develops and a decrease in the amount of oxygen carried by the blood is observed. Anemia causes physical weakness, problems with the heart and kidneys, and can lead to early death in people homozygous for the mutant allele.
Chromosomal mutations.
Significant changes in chromosome structure affecting several genes.
Types of chromosomal mutations:
A B IN G D E AND Z – normal chromosome.
A B IN G D E AND - loss (loss of end part
chromosomes)
A B IN D E AND Z – deletion (loss of internal
chromosome region)
A B IN G D E G D E AND Z – duplication (doubling some
any part of the chromosome)
A B IN G AND E D Z – inversion (rotate the area inside
chromosomes at 180˚)
Cry of the Cat Syndrome (chromosomal disease)
Reduction of one arm of chromosome 5.
- Characteristic crying, reminiscent of a cat's cry.
- Profound mental retardation.
- Multiple anomalies of internal organs.
- Stunted growth.
Genomic mutations.
They usually arise during meiosis and lead to the acquisition or loss of individual chromosomes (aneuploidy) or haploid sets of chromosomes (polyploidy).
Examples of aneuploidy are:
- Monosomy general formula 2n-1 (45, XO), disease – Shereshevsky-Turner syndrome.
- Trisomy, general formula 2n+1 (47, XXX or 47, XXY), disease - Klinefelter syndrome.
Down syndrome.
Trisomy on chromosome 21.
Mental and physical retardation.
Half-open mouth.
Mongoloid face type. Slanted eyes. Wide bridge of nose.
Heart defects.
Life expectancy decreases by 5-10 times
Patau syndrome.
Trisomy 13
Microcephaly (shrinkage of the brain).
Low sloping forehead, narrowed palpebral fissures.
Cleft upper lip and palate.
Polydactyly.
High mortality (90% of patients do not survive to 1 year).
Factors that cause mutations are called mutagenic.
Mutagenic factors include:
1) Physical (radiation, temperature, electromagnetic radiation).
2) Chemicals (substances that cause poisoning of the body: alcohol, nicotine, colchicine, formaldehyde).
3) Biological (viruses, bacteria).
The meaning of mutations
Mutations can be beneficial, harmful or neutral.
- Useful Mutations: mutations that lead to increased resistance of the body (resistance of cockroaches to pesticides).
- Harmful mutations: deafness, color blindness.
- Neutral mutations: mutations do not affect the viability of the organism in any way (eye color, blood type).
Homework:
- Section 3.12 of the textbook.
- Questions, page 122.
- Message on the topic “Shereshevsky-Turner syndrome”.
